Background: There is increased need to develop specific biomarkers for multiple sclerosis (MS) to aid in the diagnosis, improve the management of patients and the monitoring of the effectiveness of treatment. Oligoadenylate synthetase 1 (OAS1) is up regulated by type 1 interferon. A single nucleotide polymorphism (SNP) in exon 7 of OAS1 results in differential enzyme activity. Objective: To correlate different OAS1 genotypes, in patients with relapsing remitting multiple scleroses (RRMS) under interferon-beta (IFN β) therapy, with disease activity. Subjects and Methods: OAS1 genotype was assessed in 20 patients with RRMS and 20 age and gender matched healthy controls. All patients were medicated with IFN β. The patients were subdivided in terms of disease activity assessed by Expanded Disability Status Scale (EDSS), in two groups; group I with minimal disease activity and group II with severely active disease. All patients were followed up every 6 months for a period of 2 years. Results: Genotyping analysis of the OAS1 gene revealed a significant difference between RRMS patients and control group, with lower frequency of GG in patients (25%) compared to controls (65 %) (p = 0.0001). Furthermore, AA genotype was detected 35% of patients compared to 0% in controls (p = 0.01). Regarding disease activity, AA genotype had a significantly higher frequency (71.4%) in patients with severely active disease compared to 15.4% in patients with minimally active disease (p=0.0001). Conclusions: The A-allele is considered risky and the G is protective, so those with the AA genotype in particular should be carefully monitored for evidence of disease activity. Conversely, GG genotype may protect against increased disease activity.

Introduction

Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system, the etiology and pathogenesis of which remain largely elusive. The most common form of MS is the relapsing–remitting form (RRMS), in which episodes of acute worsening of neurological function (relapses) are followed by partial or complete recovery periods (remissions) free of disease progression.1,2

Type 1 interferons (IFNs) are innate immune cytokins that activate the JAK/Stat signaling pathway leading to induction of IFN-stimulated genes. The 2′,5′-OAS family is central to the IFN antiviral pathway for viruses whose replication includes production of double-stranded RNA. One member of this family of proteins, OAS1, induces RNAseL, resulting in degradation of viral RNA, inhibition of virus replication, and promotion of cellular apoptosis.1

Several OAS1 polymorphisms have been reported; one located at the exon 7 splice-acceptor site results in alternative splicing of the OAS1 mRNA. Although clinical trials have proven the efficacy of interferon-beta (IFN β) in the treatment of RRMS2-4, over one-third of patients have continuing significant disease activity.5 On purely clinical grounds, patients have variously been considered to have responded poorly, based on relapse occurrence6-9 or on disability progression while receiving IFN β therapy.10 Therefore, cohorts of patients receiving IFN β can be informative for evaluating general determinants of disease activity.

Aim of work: to examine the relationship between OAS1 genotype and indices of disease activity in RRMS under IFN β therapy.

Subjects and Methods

Twenty patients with RRMS according to revised McDonald criteria11 were enrolled from an outpatient and inpatient population attending Neurology Department, Tanta University Hospital. Twenty unrelated age- and gender-matched volunteers, with no history of MS or other neurologic disease, were recruited as a control group. All patients received IFNβ therapy and followed up every 6 months over a period of 2 years from January 2010 to January 2012. The Ethics Committee of Hospital approved the study, and a written informed consent was obtained from each participant.

📝 Need Help With This Topic?

Get a custom-written paper by an expert in this subject. Plagiarism-free, on time, any citation style.

  • ✓ PhD & Masters qualified writers
  • ✓ Turnitin-safe — 0% similarity
  • ✓ Free revisions + money-back guarantee
Get My Paper Now

From $11/page · All academic levels

For all patients, baseline data collected included disease duration, age at onset, relapse history prior to therapy, and clinical disability measured using the Expanded Disability Status Scale (EDSS).12 Relapses were defined as an episode of neurologic disturbance lasting for at least 24 hours and not caused by a change in core body temperature or infection.13 Disability progression was defined as an increase in EDSS score by 1 point from baseline confirmed at 6 months.5

Genomic DNA was isolated from peripheral blood samples. Primers were designed to specifically amplify a 347-bp product surrounding the rs10774671 SNP. A total of 5 grams of genomic DNA was amplified by PCR. Primer sequences used were; rs 10774671 – forward, TCCAGATGGCATGTCACAGT and reverse, AGAAGGCCAGGAGTCAGGA.

Amplification conditions included initial denaturation at 94 centigrade for 2 minutes, followed by 28 cycles at 94 centigrade for 20 seconds, 62 centigrade for 40 seconds 72 centigrade for 30 seconds, with a final extension for 7 minutes at 72 centigrade. The PCR products were digested with the ALU1 restriction enzyme. Digested products were analyzed by agrose gel electrophoresis and genotypes were assigned, the A-allele coding for a truncated form with low activity and the G conferring high enzymatic activity.

Patients were assigned to 1 of 2 groups. Group I included minimal disease activity; patients who experienced a maximum of 1 relapse after 24 months of IFNβ therapy and had no sustained disability progression. Group II included a severely active disease; patients who had 2 or more relapses on IFNβ therapy over 24 months with or without sustained disability progression.14

Statistical Analysis

SPSS 10 was used for data analysis.15 P value <0.05 was considered significant.

Results

Patients with MS (n = 20; 62% women), mean age 28 years (range 23-59), mean EDSS 2.7 (range 0-8.0) were studied. The control group (n = 20; 58% women) had a mean age of 26 years.

🌟 Writers Who Have Helped Students Like You

Our expert writers specialise in this subject and deliver original, well-researched papers.

S
Dr. Sarah M.★★★★★ 4.97 · 1,240 orders
Nursing & Healthcare · PhD Edinburgh
J
Prof. James K.★★★★★ 4.95 · 980 orders
Business & Law · MBA London

The A-allele was found in 55% of patients with MS, compared to 17.5% of the controls, while the G-allele was found in 45% of patients with MS compared to 82.5% of controls. Allele frequency differed between the MS cohort and control subject (OR 7.85, 95% CI, 2.8 –21.75, p= 0.001). The OAS1 genotypes showed a strong bias in the distribution: 7 out of 20 MS patients (35%) were homozygous for the A-allele (AA) compared to none of 20 controls (0%) , 8/20 (40%) of the patients with MS were heterozygous for G-allele (AG) compared to 7/20 (35%) of controls, on the other hand 5/20 (25%) of patients with MS were homozygous for the G-allele (GG) compared to13/20 (65%) of controls. MS patients had a statistically significant higher frequency of homozygous genotypes (P=0.01 for the AA genotype and 0.0001 for the GG genotype) compared to controls (table 1).

Of the 7 patients with severe disease activity (group II), the A-allele frequency was significantly higher (78.6%) compared to 23.1% in patients presented with minimal activity (group I). Conversely, the G-allele frequency was significantly higher (76.9%) in group I patients compared to 21.4 % in group II patients (OR 7.32, 95% CI, 1.19 –144.9, p= 0.001) (table 2). Regarding OAS1 homozygous genotype frequency, of the 7 patients with severe disease activity (group II), 5 (71.4%) were homozygous AA which was significantly higher compared to 2/13 (15.4%) in group I patents (OR 16, 95% CI, 1.57 –144.9, p= 0.0001). On the other hand, homozygous GG genotype frequency was significantly higher 4/13 (30.7%) in patients with minimal disease activity (group I) compared to 1/7 (14.3%) in group II (OR 21, 95% CI, 2.94 –331.21, p= 0.01). Heterozygous AG genotype distribution was significantly higher in group I 7/13 (53.8%) compared to 1/7 (14.3%) in group II patients (OR 3.66, 95% CI, 1.14–60.03 p=0.001) (table2).

Discussion

Epidemiologic and genetic findings suggest that MS is an acquired autoimmune disease triggered by unknown environmental factors in genetically susceptible individuals.16

It is accepted that infection may trigger an autoimmune cascade of events. The role of OAS1 in innate host responses to viral infection is well established; OAS1 activates RNAseL, leading to degradation of RNA and suppression of virus replication.16

Several OAS1 polymorphisms have been reported; one located at the exon 7 splice-acceptor site results in alternative splicing of the OAS1 mRNA. The G-allele conserves the splice site, generating a p46 enzyme isoform, whereas the A-allele ablates the splice site, resulting in a dual-function antiviral/proapoptotic p48 isoform and a novel p52 isoform.17 These alleles have been associated with altered enzyme activity, with OAS1 enzyme activity varying in a dose-dependent manner across the GG, AG, and AA genotypes.

Differential OAS1 enzyme activity dependent on OAS1 genotype may determine, in part, the degree of antiviral or proapoptotic effectiveness of endogenous interferons, possibly influencing susceptibility to MS.14

In addition to its role in viral infections, alternative splicing of the OAS1 gene leads to isoforms with different functions. Only individuals who have at least one copy of the G-allele can produce the p46 isoform. Individuals homozygous for the A-allele produce the p48/p52 isoforms. The p48 isoform has been shown to have proapoptotic activity, localized to a BH3 (Bcl-2 homology-3) doamain encoded by exon 7, that is independent of it’s synthetase activity.18 It is possible to speculate that high frequency, (55%) (table 1), of the A-allele observed in patients with MS in this study may indicate a tendency for apoptosis of anti-inflammatory cells, leading to excessive and prolonged inflammatory responses.14

🎉 100% Satisfaction Guaranteed — or Your Money Back

Join 12,400+ students who trust us with their academic success. Every order includes: free revisions within 30 days, plagiarism report, on-time delivery guarantee, and full confidentiality.

★★★★★

4.9/5 from 12,400+ reviews

Order & Get 20% Off

This study clarified a relationship between OAS1 genotype and disease activity. Overall, the AA genotype was associated with severe disease activity. In the current study the AA genotype was overrepresented (35%) compared to controls (0%). Moreover, the AA genotype was significantly higher (71.4%) in patients severely active disease compared to 15.4% in patients with minimal disease activity (table 2).

The above-mentioned results were in accordance with those of a recent study 14 that revealed the AA genotype of OAS1 was highly correlated with increase in RRMS disease activity. As in the current study, disease activity was delineated both clinically (increase number of relapses and deterioration of the clinical status as measured by EDSS) and radiologically by increased lesion load on successive brain MRI.

The GG genotype was associated with less inflammatory disease activity manifested by delayed breakthrough relapses on IFNβ therapy, and was underrepresented in of patients with severe disease activity. Results of the current study revealed a hierarchy in the occurrence of the GG genotype: in 65% of healthy control subjects, in 30.7% of patients with MS with minimal disease activity, in 14.3% of those with severe disease activity (tables 1 and 2). These results were also in accordance with that of O’Brien and colleagues14 which highlighted the possible protective role of GG genotype against an increase in disease activity in RRMS patients.

The mechanism by which OAS1 genotype influences relapse rate on IFNβ therapy and disease activity in general is unknown. The G-allele, which is associated with high OAS1 enzyme activity, is reduced in patients with disease activity despite IFNβ. Presumably, OAS1 activity in response to both endogenous and exogenous IFNβ is impaired in these individuals.

The higher frequency of the A-allele in patients with disease activity despite IFNβ may lead to impaired antiviral activity, leading to increase viral infections, a well-established causative factor in relapses.19

Increasing evidence supports the theory that failure to suppress relapses early on in RRMS places patients at higher risk of accumulation of disability.6,7 Results of this study suggest that all patients beginning treatment for MS should be investigated for OAS1 genotyping. Those with the AA genotype in particular are more susceptible for more severe manifestation. So, they should be carefully monitored for evidence of disease activity. Change in clinical indices (relapses or disability progression) and in MRI lesion load during the initial 6-12 months of first-line therapy might justify an early change to more active therapy. Conversely, GG genotype may protect against disease activity.

Conclusion

The A-allele is considered risky and the G-allele is protective, so those with the AA genotype in particular should be carefully monitored for evidence of disease activity. Conversely, GG genotype may protect against increased disease activity.